Skip to content
David Porkka

Work

Web development, writing, and entrepreneurial ventures

Hobbies

Making music, coding, biking, reading, and photography

What I'm Doing Now

See my "Now" page.

Location

Milwaukee, Wisconsin, United States

Liquid Fuel

Darjeeling tea, espresso, or dark roast coffee

Solid Fuel

Dark chocolate and blueberries

Genome

ATGAAAATGAACAACAAAACTGTCATCACCCAGTTTCTCCTCCTGGGACTGCCCATTTCCCTAGAGTACAAACACCTGTTCTATGCCCTGTTTCTGGCCATGTACCTCACCACTGTCCTGGGAAACCTGCTAATAATTGTCCTCATTAAACTGGACTCCCATCTCCACACACCAATGTACTTGTTTCTCAGCAACCTCTCCTTCTCTGACCTCTGCTTT

Just joking, I haven't been sequenced yet.