Skip to content
David Porkka

About Me

Work permalink

Web development, writing, and entrepreneurial ventures

Hobbies permalink

Making music, coding, biking, reading, and photography

What I'm Doing Now permalink

See my "Now" page.

Location permalink

Milwaukee, Wisconsin, United States

Liquid Fuel permalink

Darjeeling tea, espresso, or dark roast coffee

Solid Fuel permalink

Dark chocolate and blueberries

Genome permalink

ATGAAAATGAACAACAAAACTGTCATCACCCAGTTTCTCCTCCTGGGACTGCCCATTTCCCTAGAGTACAAACACCTGTTCTATGCCCTGTTTCTGGCCATGTACCTCACCACTGTCCTGGGAAACCTGCTAATAATTGTCCTCATTAAACTGGACTCCCATCTCCACACACCAATGTACTTGTTTCTCAGCAACCTCTCCTTCTCTGACCTCTGCTTT

Just joking, I haven't been sequenced yet.