Skip to content
David Porkka

Work👷‍♂️

Web development, writing, and entrepreneurial ventures

Hobbies🏂

Making music, coding, biking, reading, and photography

What I'm Doing Now

See my "Now" page.

Location📍

Milwaukee, Wisconsin, United States

Liquid Fuel

Darjeeling tea, espresso, or dark roast coffee

Solid Fuel🍫

Dark chocolate and blueberries

Genome🧬

ATGAAAATGAACAACAAAACTGTCATCACCCAGTTTCTCCTCCTGGGACTGCCCATTTCCCTAGAGTACAAACACCTGTTCTATGCCCTGTTTCTGGCCATGTACCTCACCACTGTCCTGGGAAACCTGCTAATAATTGTCCTCATTAAACTGGACTCCCATCTCCACACACCAATGTACTTGTTTCTCAGCAACCTCTCCTTCTCTGACCTCTGCTTT

Just joking, I haven't been sequenced yet.